·Basic Research·Current Issue· ·Achieve· ·Search Articles· ·Online Submission· ·About IJO· PMC
CCR7/p-ERK1/2/VEGF signaling
promotes retinal neovascularization in a mouse model of oxygen-induced
retinopathy
Lin-Hui Yuan, Xiao-Long Chen, Yu Di, Mei-Lin Liu
Department of
Ophthalmology, Shengjing Affiliated Hospital of China Medical University,
Shenyang 110000, Liaoning Province, China
Correspondence
to: Xiao-Long
Chen. Department of Ophthalmology, Shengjing Affiliated Hospital of China
Medical University, Shenyang 110000, Liaoning Province, China. 405798945@qq.com
Received:
2016-10-24
Accepted: 2017-02-14
AIM: To investigate
the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced
retinopathy (OIR).
METHODS: Neonatal
C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR
control (treated with scramble siRNA), and OIR treated (treated with CCR7
siRNA). Normoxia group was not specially handled. Postnatal day 7 (P7) mice in
the OIR group were exposed to 75%±5% oxygen for 5d (P7-P12) and then maintained
under normoxic conditions for 5d (P12-P17). Mice in the OIR control and OIR
treated groups were given injections of scramble or CCR7 siRNA plasmid on P12
before returning to normoxic conditions for 5d (P12-P17). Retina samples were
collected from all mice on P17, stained with adenosine diphosphatase (ADPase),
and retinal neovascularization (RNV) was assessed. Retinas were also stained
with hematoxylin and eosin (H&E) for RNV quantitation. The distribution and
expression of CCR7, p-ERK1/2 and vascular endothelial growth factor (VEGF) were
assessed via immunohistochemistry, Western blot, and quantitative
real-time polymerase chain reaction
(qRT-PCR).
RESULTS: High oxygen
promoted retinal neovascularization (P<0.05) and increased the number
of endothelial nuclei in new vessels extending from the retina to the vitreous
body; CCR7 promoted this process (P<0.05). CCR7 and VEGF mRNA were
expressed at higher levels in the OIR and OIR control groups than in the
normoxia and OIR treated groups. CCR7, p-ERK1/2, and VEGF protein were
expressed in the retinas of mice in the OIR and OIR control groups.
Intravitreal injection of CCR7 siRNA significantly reduced CCR7, p-ERK1/2, and
VEGF expression in the OIR mouse model (all P<0.05). CCR7
significantly enhanced the neovascularization and non-perfusion areas in the
OIR group (P<0.05). CCR7 siRNA significantly reduced levels of
p-ERK1/2 and VEGF as compared to OIR controls (P<0.05).
CONCLUSION: These results
suggest that CCR7/p-ERK 1/2/VEGF signaling plays an important role in OIR. CCR7
may be a potential target for the prevention and treatment of retinopathy of
prematurity.
KEYWORDS: chemokine receptor type
7; vascular endothelial growth factor; extracellular signal-regulated kinase;
retinal neovascularization; retinopathy of prematurity
DOI:10.18240/ijo.2017.06.06
Citation: Yuan LH,
Chen XL, Di Y, Liu ML. CCR7/p-ERK1/2/VEGF signaling promotes retinal
neovascularization in a mouse model of oxygen-induced retinopathy. Int J
Ophthalmol 2017;10(6):862-869
Article
Outline
C-C chemokine
receptor type 7 (CCR7) is mainly expressed in immunocytes such as dendritic
cells, naive T cells, B cells, regulatory T cells, memory T cells, and natural
killer (NK) cells. CCR7 participates in many physiological and pathological
processes in vivo[1-2]
and mediate cell migration and angiogenesis in many diseases[3].
The
extracellular signal-regulated kinase (ERK) signaling pathway participates in
the proliferation and angiogenesis of endothelial cells in vitro. The
ERK signaling pathway is involved in the release of vascular endothelial growth
factor (VEGF) in the retinas of diabetic rats[4].
VEGF is known as the most powerful angiogenesis promoting factor. However, the
relationship between CCR7, ERK, and VEGF in retinopathy of prematurity (ROP)
has not been illustrated, and the action of CCR7 in retinal neovascularization
(RNV) during ROP remains unclear. Therefore, we measured the expression of
CCR7, p-ERK1/2, and VEGF in RNV to investigate the role of CCR7/p-ERK1/2/VEGF
signaling in the mouse model of oxygen-induced retinopathy (OIR).
Animals All experiments were performed in
accordance with guidelines set by the Animal Experiment Committee of the
Shengjing Hospital of China Medical University, and the study was approved by
Shengjing Hospital of China Medical University’s Ethics Committee. Mice were
housed in a barrier facility with free access to normal food and tap water.
They were maintained under standard conditions for lighting (a 12h/12h
light/dark cycle), temperature (23℃-25℃), and humidity (50%-60%).
Animal
Model Specific pathogen-free healthy
C57BL/6J neonatal mice (China Medical University, Shenyang, China) were evenly
randomized into four groups: normoxia, OIR, OIR control (treated with scramble
siRNA), and OIR treated (treated with CCR7 siRNA). Mice in the OIR group were
handled based on Smith’s method[5]. On postnatal
day 7 (P7), mice in the the last 3 groups as well as their dams were
transferred into a specially made glass case then exposed to 75%±5% oxygen for
5d (P7-P12). The mice in OIR group were returned to room air (normoxic
conditions) for 5d (P12-P17). Mice in the last two groups were administered
injections of 1 μL scramble or CCR7 siRNA plasmid with a 33-gauge needle
attached to a Hamilton syringe on P11, and then returned to normoxic
conditionsfor 5d (P12-P17). Mice in the normoxia group were maintained under
normoxic conditions for 17d (P0-P17). Mice were humanely euthanized by cervical
dislocation on P17, and then their eyeballs were harvested.
Small Interfering
RNA CCR7 and scrambled small interfering
RNA (siRNA) was purchased from GenePharma Co. Ltd. (Shanghai, China). The
sequence of CCR7 siRNA used is 5’-GAAGUGCAUACACCGAGAC-3’, and its efficacy has
been previously demonstrated[6].
Observation
of Retinal Neovascularization Eyeballs were fixed with
4% paraformaldehyde for 3h. The cornea and lens were removed, then the entire
retina was dissected and radial cut into four quadrants. Retinas were stained
with magnesium-activated adenosine diphosphatase (ADPase). ADPase stained
retinal flat mounts were carefully imaged with an optical microscope (Olympus
Corporation, Tokyo, Japan). Images were carefully examined to assess the
severity of neovascularization with Adobe Photoshop (Adobe Systems Incorporated,
San Jose, CA, USA).
Quantification
of Retinal Neovascularization To quantify preretinal
neovascular cells, retinal structures were analyzed on 6-µm H&E stained
sections. Eyeballs were fixed with 4% paraformaldehyde for 24h, then embedded
in paraffin. Whole eyes were sagittally cut into serial sections (6-µm thick)
through the cornea and parallel to the optic nerve, and then stained with
H&E, dehydrated, vitrified, mounted, observed, and imaged with a light
microscope (Olympus B201, Olympus Corp., Tokyo, Japan). Three blinded
researchers counted the cells.
Immunohistochemistry Eyeballs were fixed with 4%
paraformaldehyde then dehydrated with ethanol and xylene. Deparaffinized the
eye tissue sections. For heat-induced antigen retrieval, antigen retrieval buffers
were prepared with citric acid and sodium citrate. Sections were incubated with
rabbit anti-CCR7 polyclonal antibody (1:200; Abcam, Cambridge, UK), rabbit
anti-p-ERK1/2 (1:150; Cell Signaling Technology, Boston, MA, USA), and rabbit
anti-VEGF polyclonal antibody (1:100; Proteintech, Chicago, IL, USA) overnight
at 4℃. Sections were then incubated with biotinylated secondary antibody
(1:1000; Zhongshan Jinqiao Biotechnology Co. Ltd., China) and the
avidin-biotinylated peroxidase complex was activated. Primary antibody was
replaced with PBS for negative controls. The peroxidase reaction was developed
with horseradish peroxidase labeled avidin/streptomycin, and sections were
colored with dimethyl amino-azo-benzene (DAB), dehydrated with alcohol, and
sealed with neutral gum. Images were digitally captured using an Olympus B201
optical microscope.
Quantitative
Real-time Reverse Transcriptional Polymerase Chain Reaction RNA was extracted from retinal
samples with Trizol (Invitrogen Corp., Carlsbad, CA, USA). Reverse transcription into cDNA was
performed with the reverse transcriptase kit TAKARA 047A (PrimeScript RT
Reagent kit-Perfect Real-Time; Takara Bio, Otsu, Japan) according to the
manufacturer’s instructions. Primers were designed and purchased from Sangon
Biotech Co. Ltd. (Shanghai, China); β-actin served as a normalizing control.
The sequences of primers used are shown in Table 1. The 2-ΔΔCt
method was used to determine relative quantification of gene expression[7].
Table 1 Primer sequences for
qRT-PCR
Gene |
Primer sequences (5′-3′) |
Product length (bp) |
Tm (℃) |
|
β-actin |
Forward |
CCTCCTCCTGAGCGCAAGTA |
117 |
55 |
Reverse |
GATGGAGGGGCCGGACT |
|||
CCR7 |
Forward |
AACGGGCTGGTGATACTGAC |
139 |
55 |
Reverse |
AGGACTTGGCTTCGCTGTAG |
|||
VEGF |
Forward |
CAACTTCTGGGCTCTTCTCG |
144 |
55 |
Reverse |
CCTCTCCTCTTCCTTCTCTTCC |
qRT-PCR:
Quantitative real-time reverse transcriptional polymerase chain reaction; CCR7:
C-C chemokine receptor type 7; VEGF: Vascular endothelial growth factor; Tm:
Temperature; bp: Base pair.
Western Blot We added
500 μmol/L RIPA Lysis Buffer (Sigma-Aldrich Co. St Louis,
MO, USA) and 5 μmol/L phenylmethanesulfonyl fluoride (Sigma-Aldrich
Co. St Louis, MO, USA) to the retinas. For retinal samples in which p-ERK1/2
was to be tested, we also added 5 μmol/L protein phosphatase inhibitor. We then
determined protein concentration using the BCA method. Membranes were then
incubated with horse radish peroxidase-conjugated secondary antibody (1:2000;
Zhongshan Jinqiao Biotechnology Co. Ltd., Beijing, China) for 2h. Signals were
detected with enhanced chemiluminescence Azure c300 chemiluminescent Western
blot imaging system (Azure Biosystems, Inc., USA). The ratio between the
optical densities of the protein of interest and GAPDH in each same sample was
calculated to determine relative protein content.
Statistical
Analysis Statistical analysis of
all data was performed using SPSS 22.0 for Windows (SPSS Inc., Chicago, IL,
USA). All data are represented as mean±standard deviation (SD). Statistical
significance was evaluated by one-way analysis of variance (ANOVA) with the
least significant difference post hoc analysis. P<0.05 was considered
statistically significant.
Quantitation
of Retinal Neovascularization We examined the retinal
vasculature in the normoxia, OIR, OIR control, and OIR treated groups using
ADPase in retinal flat mounts at P17 (Figure 1). No abnormal blood vessels were
observed in the retinas of the normoxia group. Two layers of retinal vessels
were evenly distributed in the retina, the superficial blood vessels were well
formed, and the deep blood vessel formed a polygon mesh pattern. The blood
vessels in OIR and OIR control groups showed non-perfusion areas and
neovascularization. The ratio of new blood vessel area to total retinal area
was higher in the OIR treated (0.34±0.04), OIR (0.62±0.08), and OIR control
groups (0.60±0.05) than in the normoxia group (0.25±0.01; all P<0.05).
In contrast, retinas in the OIR treated group (0.34±0.04) developed less severe
neovascular tufts and regions of non-perfusion as compared to the OIR and OIR
control groups (both P<0.05), which demonstrates a strong inhibitory
effect of CCR7 siRNA on RNV in the OIR treated group. No significant difference
was detected between the OIR and OIR control groups (P>0.05).
Figure 1
Inhibitory effect of CCR7 siRNA on RNV in the OIR model Representative retinal angiographs
from the eyes of mice in the normoxia (A), OIR (B), OIR control (C), and OIR
treated groups (D). The results of statistical analysis are illustrated in (E).
The blue arrows indicate neovascularization (magnification: ×100). Data are
shown as mean±SD (n=15). aP<0.05 vs normoxia
group, cP<0.05 vs OIR group, and eP<0.05
vs OIR control group.
Qualitative
of Retinal Neovascularization H&E stained retina
sections are shown in Figure 2. Preretinal neovascular cells were nearly absent
from retinas in the normoxia group (Figure 2A) but more abundant in the OIR
(Figure 2D) and OIR control (Figure 2C) groups than in the OIR treated (Figure
2B) group, demonstrating an inhibitory effect of CCR7 siRNA on RNV in the OIR
treated group.
Figure 2
Effect of CCR7 siRNA on pre-RNV in mice with OIR
Images shown are of representative retinal sections from the normoxia
(A), OIR treated (B), OIR control (C), and OIR (D) groups. The red arrows indicate
preretinal neovascular cells (magnification: ×400).
CCR7/p-ERK1/2/VEGF
Signaling in the Oxygen-induced Retinopathy Mouse Model Immunohistochemistry was analyzed
with Nis Elements BR3.0 (Nikon Instruments Inc., Japan) (Figure 3). The mean
density of CCR7, p-ERK1/2, and VEGF was low in the normoxia and OIR treated
groups, but high in the OIR and OIR control groups (all P<0.05).
These results indicate that hypoxia induced the expression of CCR7, p-ERK1/2,
and VEGF, and that reducing CCR7 could inhibit the expression of p-ERK1/2, and
VEGF.
Figure 3
Hypoxia-induced CCR7 expression is mediated through the p-ERK1/2-VEGF pathway
in the OIR mouse model A: Protein
expression of CCR7, p-ERK1/2, and VEGF was determined by immunohistochemistry
(magnification: ×400); B: The mean density of CCR7, p-ERK1/2, and VEGF in each
group. aP<0.05 vs normoxia group, cP<0.05
vs OIR group, and eP<0.05 vs OIR control
group.
Expression
of C-C Chemokine Receptor Type 7 and Vascular Endothelial Growth Factor The relative expression of CCR7 mRNA
as compared to the normoxia group was 2.51±0.04 (OIR treated), 6.95±0.75 (OIR
control), and 6.72±0.77 (OIR) and the expression of VEGF was 1.97±0.04 (OIR
treated), 3.78±0.29 (OIR control), and 4.04±0.16 (OIR). CCR7 and VEGF mRNA levels
in the OIR treated group were decreased as compared to the OIR and OIR control
groups (all P<0.05). Additionally, the expression of these mRNAs in
the OIR and OIR control groups was increased as compared to the normoxia group
(all P<0.05). No significant difference was detected between the OIR
and OIR control groups (all P>0.05) (Figure 4).
Figure 4
CCR7 siRNA inhibited RNV through inhibition of the expression of VEGF in the
OIR mouse model The mRNA expression of CCR7
and VEGF was determined by qRT-PCR. Data are shown as mean±SD (n=10). aP<0.05
vs normoxia group, cP<0.05 vs OIR group, and
eP<0.05 vs OIR control group.
CCR7/p-ERK1/2/VEGF
Signaling Activity in Oxygen-induced Retinopathy Mice The relative protein quantity of CCR7
was 0.51±0.01, 0.68±0.02, 1.16±0.01, and 1.16±0.03 in the normoxia, OIR
treated, OIR control, and OIR groups; p-ERK1/2 was 0.77±0.05, 1.00±0.08,
1.53±0.07, and 1.57±0.05; VEGF was 1.30±0.04, 1.85±0.03, 2.41±0.05, and
2.44±0.04, respectively. As compared to the OIR control group, CCR7, p-ERK1/2,
and VEGF protein levels were decreased in the OIR treated group (all P<0.05).
Additionally, the expression of each of these proteins was significantly
increased in the OIR and OIR control groups as compared to the normoxia group
(all P<0.05), whereas no significant difference was detected between
the OIR and OIR control groups (all P>0.05) (Figure 5).
Figure 5
CCR7 siRNA decreases the protein expression of p-ERK1/2 and VEGF CCR7 (A), p-ERK1/2 (B), and VEGF (C)
protein expression was determined by Western blot. Data are shown as mean±SD (n=10).
aP<0.05 vs normoxia group, cP<0.05
vs OIR group, eP<0.05 vs OIR control group.
Chemokines are
chemical induction factors for specific G-protein coupled receptors (GPCRs).
Chemokines belong to a family of cytokines, are secreted by different cell
types, and play a role in chemotaxis. They play an important role in both
normal and abnormal physiological processes. CCR7 is a member of the chemokine
receptor family. CCR7 expression on the cell surface combined with activation
by its high affinity ligands, CCL19 and CCL21, can promote integrin
aggregation, thereby activating the coupled G-protein in the cytoplasm. This
activation quickly induces Ca2+ mobilization and stimulates the
mitogen activated protein kinase (MAPK) and focal adhesion kinase (FAK)
pathways, thereby activating protein kinase C and downstream guanosine
triphosphatase (GTP)-binding tyrosine kinases. This stimulates signal
transduction in a variety of ways, recombinants the bone scaffold protein in
cells, cause target cell migration and produce efficient chemotaxis. A variety
of stimulating factors such as growth factors, cytokines, viruses, GPCR
ligands, and oncogenic proteins can activate this pathway[8].
CCL19/21-CCR7
signaling plays an important role in the initiation, development, and
metastasis of many tumor types[9-11].
CCR7 mediates angiogenesis in different tumor microenvironments as well as
metastasis-mediated angiogenesis[12].
Pathological angiogenesis that occurs during thymic hyperplasia in myasthenia
gravis may be related abnormal recruitment of vascular endothelial cells by
CCL21[13].
CCL19[14] and CCL21[15]
expression was detected in vascular endothelial cells in the synovial tissue of
patients with rheumatoid arthritis (RA). CCL19 and CCL21 induce the formation
of potent angiogenic factors in macrophages and RA fibroblasts[16]. In RA, CCR7 and its ligands regulate the formation
of new blood vessels through different signaling pathways[17].
Furthermore, CCR7 and its ligands mediate cell migration and angiogenesis in
many additional diseases[3]. Our data show that
CCR7 promotes retinal neovascularization in OIR, and that CCR7 inhibition
reduced this retinal neovascularization. We thus conclude that CCR7 promotes
RNV in OIR.
ERK is a
serine/threonine protein that was isolated and identified by Boulton et al[18]. The ERK signaling pathway plays a key role in
transducing mitogenic cell signals[18]. ERK signals is the
downstream of the three stages of MAPK signaling reactions, that is, the
Ras-Raf-MEK cascade. The Ras-Raf-MEK-ERK pathway is one of the most important
signal transduction pathways involved in cell growth, development, division,
migration, metabolism, apoptosis, and other physiological processes in vivo[19-20]. Phosphorylated ERK can convert
extracellular stimuli into intracellular reactions, promoting the
phosphorylation and activation of multiple transcription factors in the
nucleus, thereby enhancing transcriptional activity. ERK promotes tumorigenesis
by mediating extracellular matrix degradation, adhesion, and migration of tumor
cells as well as angiogenesis[19-21].
Various growth factors, ions, and hydrogen peroxide can activate the ERK
pathway through phosphorylation. The ERK signaling pathway has been demonstrated
to promote proliferation and angiogenesis of endothelial cells in vitro.
In RNV diseases, the present study indicates that the ERK signaling pathway may
be involved in the development and progression of diabetic retinopathy by
regulating angiogenesis-related growth factors. The results of our study show
that in the group with high RNV, p-ERK1/2 expression increased; in the
normoxiaand OIR treated groups, p-ERK1/2 expression and RNV decreased
synchronously. It can thus be inferred that p-ERK1/2 promotes RNV in OIR.
VEGF
participates in many physiological and pathological processes in the body,
strongly stimulates vascular endothelial proliferation and migration as well as
maintenance of vascular integrity[22], increases
vascular permeability[23], and promotes
angiogenesis[24-25]. VEGF acts
through both autocrine and paracrine signaling, promoting endothelial cell
growth in arteries, veins, and lymphatic vessels by activating specific
receptors on vascular endothelial cells[26]. VEGF
expression promotes normal physiological vascular growth[27-29]. Abnormal VEGF expression can occur under
pathological conditions. In ischemic disease, hypoxia can stimulate VEGF
expression. The resulting strong induction of endothelial cell mitosis promotes
the formation of new blood vessels and improves tissue blood supply. VEGF is a
key factor for ocular neovascularization, directly promoting the formation and
development of new blood vessels; its expression is closely related to disease
severity. In this study, VEGF also played a role in promoting RNV.
CCR7 signal
can through the ERK pathway[30]. CCR7 can
activate MAPK family proteins including p38, JNK, and ERK1/2 via
G(i)-dependent mechanisms[31]. In monocytes, the
phosphorylation of ERK1/2, p38, and JNK can be induced by the combination of
CCR7 and CCL19, thus playing an important role in cell migration[32]. The expression of
CCR7 was positively correlated to p-ERK1/2 in this study. CCR7
inhibition-mediated suppression of p-ERK1/2 signaling has also been
shown to be important for the regulation of angiogenesis via VEGF and
other pathways. In bovine retinal microvascular endothelial cells in vitro,
VEGF stimulated the phosphorylation of ERK1/2 in a dose-dependent manner to
promote cell proliferation and endothelial cell formation[33].
In a rat model of ROP, the ERK-VEGF signaling axis has been demonstrated to
play a key role in endothelial cell proliferation. VEGF and other growth
factors affect cellular functions through the ERK pathway, thereby promoting
the transcription and expression of select genes, and in so initiating cell
proliferation and differentiation. This signaling pathway plays an important
role in cell growth, development, and proliferation[34].
In this study, p-ERK1/2 and VEGF expression was high in the group with high
levels of RNV; in the group with less RNV, p-ERK1/2 and VEGF expression
was reduced accordingly. Thus, we concluded that p-ERK1/2/VEGF plays a
prominent role in the OIR model of RNV.
It has been
reported that CCR7 increases VEGF expression in fibroblasts such as synovial
cells in RA and osteoarthritis through the p-ERK1/2 signaling pathway, and
thereby promotes angiogenesis[17]. CCR7 can also
increase VEGF expression in non-small cell lung cancer cells through the
p-ERK1/2 signaling pathway, thus promoting tumor angiogenesis[32]. Taken together, all
of the above studies have shown that the CCR7/p-ERK1/2/VEGF pathway promotes
the production of new blood vessels. In addition, the CCR7-VEGF pathway has
been shown to promote RNV[35]. The present study
showed that the expression of CCR7 and VEGF in the OIR model was correlated
with high expression of CCR7/VEGF, and the expression of CCR7 and VEGF
decreased after CCR7 was inhibited.
Considering
our data and those of previous reports, the CCR7/p-ERK1/2/VEGF pathway may be
important in promoting neovascularization in OIR. We have found a positive
correlation between CCR7, p-ERK1/2, and VEGF in the present study. Expression
of CCR7 lead to p-ERK1/2 and VEGF expression as well as neovascularization, and
CCR7 inhibition suppressed p-ERK1/2 and VEGF expression and neovascularization.
Thus, we speculate that CCR7/p-ERK1/2/VEGF signaling plays an important role in
ROP.
Vitreous
cavity injection is a definitive and effective way to treat RNV; however, siRNA
injection has not been applied in RNV treatments. Our research shows that CCR7
siRNA can be an effective part of anti-VEGF therapy. Unfortunately, the
delivery of siRNA, toxicity, and off-target effects have not been successfully
resolved; these challenges must be addressed in order to use siRNA for gene
therapy.
In conclusion,
CCR7/p-ERK1/2/VEGF signaling promotes RNV in a mouse model of OIR.
CCR7-targeting intervention via siRNA represents a potential
anti-angiogenic therapy for RNV of ROP, and may contribute to future
therapeutic strategies.
Foundation:
Supported
by the Science and Technology Planning Foundation of Liaoning Province
(No.2010225034).
Conflicts
of Interest: Yuan LH, None; Chen XL, None; Di Y, None; Liu ML,
None.
1 MartIn-Fontecha A, Sebastiani S, Höpken UE,
Uguccioni M, Lipp M, Lanzavecchia A, Sallusto F. Regulation of dendritic cell
migration to the draining lymph node: impact on T lymphocyte traffic and
priming.<ii>J Exp
Med</ii> 2003;198(4):615-621. [PMC free article] [PubMed]
2 Schweickart VL, Raport CJ, Godiska R, Byers MG, Eddy
RL Jr, Shows TB, Gray PW. Cloning of human and mouse EBI1, a lymphoid-specific
G-protein-coupled receptor encoded on human chromosome 17q12-q21.2.
<ii>Genomics</ii> 1994;23(3):643-650. [PubMed]
3 Qin Y, He LD, Sheng ZJ, Yong MM, Sheng YS, Wei Dong
X, Wen Wen T, Ming ZY. Increased CCL19 and CCL21 levels promote fibroblast
ossification in ankylosing spondylitis hip ligament tissue. <ii>BMC
Musculoskelet Disord</ii> 2014;15:316. [PMC free article] [PubMed]
4 Ye X, Xu G, Chang Q, Fan J, Sun Z, Qin Y, Jiang AC.
ERK1/2 signaling pathways involved in VEGF release in diabetic rat retina.
<ii>Invest Ophthalmol Vis Sci </ii>2010;51(10):5226-5233. [PubMed]
5 Smith LE, Wesolowski E, McLellan A, Kostyk SK,
D'Amato R, Sullivan R, D'Amore PA. Oxygen-induced retinopathy in the mouse.
<ii>Invest Ophthalmol Vis Sci</ii> 1994;35(1):101-111. [PubMed]
6 Chi BJ, Du CL, Fu YF, Zhang YN, Wang RW. Silencing
of CCR7 inhibits the growth, invasion and migration of prostate cancer cells
induced by VEGFC. <ii>Int J Clin Exp Pathol</ii> 2015;8(10):12533-12540.
[PMC free article] [PubMed]
7 Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method.<ii> Methods</ii> 2001;25(4):402-408. [PubMed]
8 Takanami I. Overexpression of CCR7 mRNA in nonsmall
cell lung cancer: correlation with lymph node metastasis.<ii> Int J
Cancer </ii>2003;105(2): 186-189. [PubMed]
9 Sarvaiya PJ, Guo D, Ulasov I, Gabikian P, Lesniak
MS. Chemokines in tumor progression and metastasis. <ii>Oncotarget</ii>
2013;4(12):2171-2185. [PMC free article] [PubMed]
10 Luker KE, Lewin SA, Mihalko LA, Schmidt BT, Winkler
JS, Coggins NL, Thomas DG, Luker GD. Scavenging of CXCL12 by CXCR7 promotes
tumor growth and metastasis of CXCR4-positive breast cancer cells.
<ii>Oncogene </ii>2012;31(45):4750-4758. [PMC free article] [PubMed]
11 Kakinuma T, Hwang ST. Chemokines, chemokine
receptors, and cancer metastasis.<ii> J Leukoc Biol</ii>
2006;79(4):639-651. [PubMed]
12 Zhang Q, Sun L, Yin L, Ming J, Zhang S, Luo W, Qiu
X. CCL19/CCR7 upregulates heparanase via specificity protein-1 (Sp1) to promote
invasion of cell in lung cancer. <ii>Tumour Biol</ii>
2013;34(5):2703-2708. [PubMed]
13 Berrih-Aknin S, Ruhlmann N, Bismuth J,
Cizeron-Clairac G, Zelman E, Shachar I, Dartevelle P, de Rosbo NK, Le Panse R.
CCL21 Overexpressed on lymphatic vessels drives thymic hyperplasia in
myasthenia. <ii>Ann Neurol</ii> 2009;66(4):521-531. [PubMed]
14 Burman A, Haworth O, Hardie DL, Amft EN, Siewert C,
Jackson DG, Salmon M, Buckley CD. A chemokine-dependent stromal induction
mechanism for aberrant lymphocyte accumulation and compromised lymphatic return
in rheumatoid arthritis. <ii>J Immunol</ii> 2005;174(3):1693-1700.[CrossRef]
15 Page G, Miossec P. Paired synovium and lymph nodes
from rheumatoid arthritis patients differ in dendritic cell and chemokine
expression. <ii>J Pathol</ii> 2004;204(1):28-38. [PubMed]
16 Pickens SR, Chamberlain ND, Volin MV, Pope RM,
Talarico NE, Mandelin AM 2nd, Shahrara S. Characterization of interleukin-7 and
interleukin-7 receptor in the pathogenesis of rheumatoid arthritis.
<ii>Arthritis Rheum</ii> 2011;63(10):2884-2893. [PMC free article] [PubMed]
17 Pickens SR, Chamberlain ND, Volin MV, Pope RM,
Talarico NE, Mandelin AM 2nd, Shahrara S. Role of the CCL21 and CCR7 pathways
in rheumatoid arthritis angiogenesis.<ii> Arthritis Rheum</ii>
2012;64(8):2471-2481. [PMC free article] [PubMed]
18 Boulton TG, Nye SH, Robbins DJ, Ip NY, Radziejewska
E, Morgenbesser SD, DePinho RA, Panayotatos N, Cobb MH, Yancopoulos GD. ERKs: a
family of proteins-erine/threonine kinases that are activated and tyrosine
phosphorylated in response to insulin and NGF. <ii>Cell</ii>
1991;65(4):663-675.[CrossRef]
19 Yoon S, Seger R. The extracellular signal-regulated
kinase:multiple substrates regulate diverse cellular functions.
<ii>Growth Factors</ii> 2006;24(1): 21-44. [PubMed]
20 Eblen ST, Slack JK, Weber MJ, Catling AD. Rac-PAK
signaling stimulates extracellular signal-regulated kinase (ERK) activation by
regulating formation of MEK1-ERK complexes. <ii>Mol Cell Biol</ii>
2002; 22(17):6023-6033.[CrossRef]
21 Valjent E, Caboche J, Vanhoutte P.
Mitogen-activated protein kinase/extracellular signal-regulated kinase induced
gene regulation in brain: a molecular substrate for learning and memory.
<ii>Mol Neurobiol</ii> 2001;23 (2-3):83-99.[CrossRef]
22 Thakker GD, Hajjar DP, Muller WA, Rosengart TK. The
role of phosphatidylinositol 3-kinase in vascular endothelial growth factor
signaling. <ii>J Biol Chem </ii>1999;274(15):10002-10007.[CrossRef]
23 Dvorak AM, Kohn S, Morgan ES, Fox P, Nagy JA,
Dvorak HF. The vesiculo-vacuolar organelle (VVO): a distinct endothelial cell
structure that provides a transcellular pathway for macromolecular
extravasation. <ii>J</ii> <ii>Leukoc Biol</ii>
1996;59(1):100-115. [PubMed]
24 Lukiw WJ, Ottlecz A, Lambrou G, Grueninger M,
Finley J, Thompson HW, Bazan NG. Coordinate activation of HIF-1 and NF-kappaB
DNA binding and COX-2 and VEGF expression in retinal cells by hypoxia.
<ii>Invest Ophthalmol Vis Sci</ii> 2003;44(10):4163-4170. [CrossRef]
25 Carmeliet P, Dor Y, Herbert JM, Fukumura D,
Brusselmans K, Dewerchin M, Neeman M, Bono F, Abramovitch R, Maxwell P, Koch
CJ, Ratcliffe P, Moons L, Jain RK, Collen D, Keshert E, Keshet E. Role of
HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis.<ii>
Nature</ii> 1998;394(6692):485-490. [PubMed]
26 Ferrara N, Davissmyth T. The biology of vascular
endothelial growth factor. <ii>Endocr Rev</ii> 1993;18(1):4-25. [PubMed]
27 Pierce EA, Foley ED, Smith LE. Regulation of
vascular endothelial growth factor by oxygen in a model of retinopathy of
prematurity. <ii>Arch Ophthalmol</ii> 1996;114(10):1219-1228.[CrossRef]
28 Stone J, Itin A, Alon T, Pe'er J, Gnessin H,
Chan-Ling T, Keshet E. Development of retinal vasculature is mediated by
hypoxia-induced vascular endothelial growth factor (VEGF) expression by
neuroglia. <ii>J Neurosci</ii> 1995;15(7 Pt 1):4738-4747. [PubMed]
29 Ozaki H, Seo MS, Ozaki K, Yamada H, Yamada E,
Okamoto N, Hofmann F, Wood JM, Campochiaro PA. Blockade of vascular endothelial
cell growth factor receptor signaling is sufficient to completely prevent
retinal neovascularization. <ii>Am J Pathol</ii> 2000;156(2):697-707.[CrossRef]
30 Shannon LA, Calloway PA, Welch TP, Vines CM.
CCR7/CCL21 migration on fibronectin is mediated by phospholipase Cgamma1 and
ERK1/2 in primary T lymphocytes. <ii>J Biol Chem</ii>
2010;285(50):38781-38787. [PMC free article] [PubMed]
31 Riol-Blanco L, Sánchez-Sánchez N, Torres A, Tejedor
A, Narumiya S, Corbí AL, Sánchez-Mateos P, Rodríguez-Fernández JL. The
chemokine receptor CCR7 activates in dendritic cells two signaling modules that
independently regulate chemotaxis and migratory speed. <ii>J Immunol
</ii>2005; 174(7):4070-4080.[CrossRef]
32 Xu Y, Liu L, Qiu X, Jiang L, Huang B, Li H, Li Z,
Luo W, Wang E. CCL21/CCR7 promotes G2/M phase progression via the ERK pathway
in human non-small cell lung cancer cells. <ii>PLoS One</ii>
2011;6(6):e21119. [PMC free article] [PubMed]
33 Bullard LE, Qi X, Penn JS. Role for extracellular
signal-responsive kinase-1 and -2 in retinal angiogenesis. <ii>Invest
Ophthalmol Vis Sci</ii> 2003; 44(4):1722-1731.[CrossRef]
34 Johnson GL, Lapadat R. Mitogen-activated protein
kinase pathways mediated by ERK, JNK, and p38 protein kinases. <ii>Science
</ii>2002; 298(5600):1911-1912. [PubMed]
35 Di Y, ChenXL, WangAY. Expression and significance
of CCR7 and VEGF in retinal endothelial cell under hypoxia. <ii>Guoji
Yanke Zazhi (Int Eye Sci) </ii>2015;15(3):403-406.